Progress in the Application of G-Quadruplex Fluorescent Probes

doi:10.6023/cjoc202503033

Abstract

G-quadruplex (G4), a non-classical nucleic acid structure rich in guanine, is widely distributed in genomes, particularly in telomeres, promoters, and viral genomes. It plays a critical regulatory role in key biological processes such as deoxyribonucleic acid (DNA) replication, transcription, and translation. Aberrations in G4 structure, abundance, or distribution are closely associated with the pathogenesis and progression of multiple diseases. Therefore, achieving highly sensitive and precise detection of G4 holds paramount significance for early disease diagnosis and effective treatment. In recent years, researchers have developed various fluorescent ligands with high specificity for G4. These ligands demonstrate broad application potential in constructing analytical sensing platforms and play pivotal roles in cutting-edge fields such as cellular imaging and precision disease diagnosis due to their unique and superior fluorescence properties. The latest breakthroughs in G4 fluorescent probes across key areas including biosensing, cellular imaging, and cancer therapy are comprehensively summarized. Based on current research status and future trends, it also provides forward-looking perspectives on the development directions of G4 fluorescent probes, aiming to offer valuable references and insights for researchers in related disciplines.

Key words: fluorescence, G-quadruplex, biosensing, bioimaging, cancer diagnosis and treatment

Cite this article

Mengmeng Lü, Xiaoxue Jia, Jianguo Wang. Progress in the Application of G-Quadruplex Fluorescent Probes[J]. Chinese Journal of Organic Chemistry, 2025, 45(11): 4070-4081.

Export EndNote|Reference Manager|ProCite|BibTeX|RefWorks

share this article

Fig. & Tab. 10

Figure 1. (A) G-quadruplanar structure; (B) parallel G4 structure; (C) trans-parallel G4 structure; (D) mixed G4 structure

Figure 2. Reported molecular structures of G4-responsive fluorescent ligands

Figure 3. Three modes of ligand combine with G4

Figure 4. Examples of metal ion detection applications based on G4: (A) Detection of potassium ions (K＋) based on the specific binding of G4 to Zn-DIGP;[31] (B) Detection of lead ions (Pb2＋) based on the specific binding of T30695 and ZnPPIX and lead ion-induced G4 assembly;[34] (C) Sensitive analysis of mercury ions (Hg2＋) by using the difference in structural stability between T-Hg-T and G4[36] (A) Copyright (2010) American Chemical Society; (B) Copyright (2010) American Chemical Society; (C) Copyright (2014) The Royal Society of Chemistry

Figure 5. Detection of thrombin aptamer based on fluorescence signal generated by G4 binding to ThT combined with exonuclease[54] Copyright (2017) Elsevier B.V.

Figure 6. Examples of nucleic acid analysis and detection platform construction based on G4: (A) CRISPER/Cas12a combined with G4 for multiple nucleic acid target strand detection;[57] (B) Quantitative analysis of SARS-CoV-2 based on the configuration of pH-regulated cDNA that binds specifically to BTMA[58] (A) Copyright (2024) American Chemical Society; (B) Copyright (2022) American Chemical Society

Fluorescent ligand	G4 name	G4 topology	E_x/E_m/nm	K_d/(µmol•L^－1)	References
NIRG-2	Pu22	Parallel	850/940	1.71±1.13	[19]
5a	Pu22	Parallel	575/650	1.549±0.080	[81]
5b	Pu22	Parallel	550/630	1.783±0.210	[81]
AI7	21CTA	Hybrid	389/500	1.3	[82]
IZIN-1	mt6363	Parallel	538/660	—	[89]
ISAP	c-Myc	Parallel	640/702	1.09	[92]
SF3	mt6363	Parallel	550/650	3.5	[93]

Table 1. Photophysical properties of some G4 probes

Figure 7. Examples of cell imaging platform construction based on G4: (A) Fluorescence response effect of SCY-5 after binding to different G4 and nucleic acid chains;[78] (B) Synthesis route of NHCouI and its binding mechanism with G4;[79] (C) IZIN-1 molecular structure and fluorescence response effects of different G4 and nucleic acid chains binding[89] (A) Copyright (2024) American Chemical Society; (B) Copyright (2023) The Royal Society of Chemistry; (C) Copyright (2021) Elsevier B.V.

Name	Sequence (5'-3')
Pu27	TTATGGGGAGGGTGGGGAGGGTGGGGAAGG
Myc-2345	TGAGGGTGGGGAGGGTGGGGAA
Myc-1245	TGGGGAGGGTTTTTAGGGTGGGGA
Myc-22	TGAGGGTGGGTAGGGTGGGTAA
Pu241	TGAGGGTGGIGAGGGTGGGGAA GG
ckit1	CAGAGGGAGGGCGCTGGGAGGAGGGGCTG
ckit2	CCCCGGGCGGGCGCGAGGGGAGGGGAGGC
bcl-2	GTCGGGGCGAGGGCGGGGGAAGGAGGGCGCGGGCGGGGA
K-ras	GGGAGGGAGGGAAGGAGGGAGGGAGGGA
VEGF	CCCGGGGCGGGCCGGGGGCGGGGTCCCGGCGGGGCGGAG
HIF-1α	GCGAGGGCGGGGGAGAGGGGAGGGGCGCG

Table 2. Reported G4 sequence information

Figure 8. Example cancer treatment methods based on G4. (A) (A) In vivo imaging principle and imaging diagram of TOH combined with G4.[91] Copyright (2024) Elsevier B.V. (B) Molecular design of NIRG-II fluorescent probe and its application in visualization of tumor lymphatic metastasis.[19] Copyright (2024) American Chemical Society

References 94

[1]	Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2005, 33, 2908. doi: 10.1093/nar/gki609 pmid: 15914667
[2]	Monsen, R. C.; Trent, J. O.; Chaires, J. B. Acc. Chem. Res. 2022, 55, 3242. doi: 10.1021/acs.accounts.2c00519
[3]	Robinson, J.; Raguseo, F.; Nuccio, S. P.; Liano, D.; Di Antonio, M. Nucleic Acids Res. 2021, 49, 8419. doi: 10.1093/nar/gkab609 pmid: 34255847
[4]	Bončina, M.; Vesnaver, G.; Chaires, J. B.; Lah, J. Angew. Chem., Int. Ed. 2016, 55, 10340. doi: 10.1002/anie.v55.35
[5]	Amato, J.; Madanayake, T. W.; Iaccarino, N.; Novellino, E.; Randazzo, A.; Hurley, L. H.; Pagano, B. Chem. Commun. 2018, 54, 9442. doi: 10.1039/C8CC03614D
[6]	Lin, Y.; Liu, J.; Bai, R.; Shi, J.; Zhu, X.; Liu, J.; Guo, J.; Zhang, W.; Liu, H.; Liu, Z. ACS Nano 2020, 14, 11846. doi: 10.1021/acsnano.0c04727
[7]	You, M.; Yang, S.; An, Y.; Zhang, F.; He, P. J. Electroanal. Chem. 2020, 862, 114017. doi: 10.1016/j.jelechem.2020.114017
[8]	Bang, I. Biochem. Z. 1910, 26, 293.
[9]	Gellert, M.; Lipsett, M. N.; Davies, D. R. Proc. Natl. Acad. Sci. U. S. A. 1962, 48, 2013. doi: 10.1073/pnas.48.12.2013
[10]	Gyllensten, U. B.; Erlich, H. A. Proc. Natl. Acad. Sci. U. S. A. 1988, 85, 7652. doi: 10.1073/pnas.85.20.7652
[11]	Sen, D.; Gilbert, W. Nature 1988, 334, 364. doi: 10.1038/334364a0
[12]	Zahler, A. M.; Williamson, J. R.; Cech, T. R.; Prescott, D. M. Nature 1991, 350, 718. doi: 10.1038/350718a0
[13]	Mohanty, J.; Barooah, N.; Dhamodharan, V.; Harikrishna, S.; Pradeepkumar, P. I.; Bhasikuttan, A. C. J. Am. Chem. Soc. 2013, 135, 367. doi: 10.1021/ja309588h
[14]	Deng, M.; Zhang, D.; Zhou, Y.; Zhou, X. J. Am. Chem. Soc. 2008, 130, 13095. doi: 10.1021/ja803507d
[15]	Han, J.; Li, J.; Luo, X.; Feng, G.; Zhang, J. Coord. Chem. Rev. 2024, 520, 216157. doi: 10.1016/j.ccr.2024.216157
[16]	Huang, Z.-H.; Zou, J.-M.; Li, X.-Q.; He, Q.; Nie, J.-F. Chin. J. Anal. Chem. 2021, 49, 1258 (in Chinese).
	(黄子恒, 邹建梅, 李小青, 何庆, 聂瑾芳, 分析化学, 2021, 49, 1258.)
[17]	Le, T. V. T.; Han, S.; Chae, J.; Park, H. J. Curr. Pharm. Des. 2012, 18, 1948. doi: 10.2174/138161212799958431
[18]	Guan, L.; Zhou, Y.; Li, X.; Mao, Y.; Li, A.; Fu, Y.; Liu, W.; Dong, S.; Liang, Z.; Zhang, Y.; Zhao, Q.; Zhang, L. Anal. Chem. 2023, 95, 9288. doi: 10.1021/acs.analchem.3c01153 pmid: 37290004
[19]	Wang, R.-X.; Ou, Y.; Chen, Y.; Ren, T.-B.; Yuan, L.; Zhang, X.-B. J. Am. Chem. Soc. 2024, 146, 11669. doi: 10.1021/jacs.3c13851
[20]	Ou, T. M.; Lu, Y. J.; Tan, J. H.; Huang, Z. S.; Wong, K. Y.; Gu, L. Q. ChemMedChem 2008, 3, 690. doi: 10.1002/cmdc.v3:5
[21]	Vashistha, V. K.; Mittal, A.; Upadhyay, P. K.; Nagar, H.; Kumar, R.; Gupta, H.; Bala, R.; Das, D. K. Russ. J. Bioorg. Chem. 2023, 49, 710. doi: 10.1134/S1068162023330014
[22]	Chen, B.-J.; Wu, Y.-L.; Tanaka, Y.; Zhang, W. Int. J. Biol. Sci. 2014. 10, 1084. doi: 10.7150/ijbs.10190
[23]	Zhang, S. L.; Wu, Y. L.; Zhang, W. ChemMedChem 2014, 9, 899. doi: 10.1002/cmdc.v9.5
[24]	Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505. doi: 10.1016/S1074-5521(98)90006-0
[25]	Shao, C.; Lu, N.; Sun, D. Chin. J. Anal. Chem. 2012, 30, 1575.
[26]	Zhao, L.; Ahmed, F.; Zeng, Y.; Xu, W.; Xiong, H. ACS Sensors 2022, 7, 2833. doi: 10.1021/acssensors.2c00992
[27]	Kong, D. M.; Ma, Y. E.; Guo, J. H.; Yang, W.; Shen, H. X. Anal. Chem. 2009, 81, 2678. doi: 10.1021/ac802558f
[28]	Lv, M.; Guo, Y.; Ren, J.; Wang, E. Nucleic Acids Res. 2019, 47, 9502. doi: 10.1093/nar/gkz749
[29]	Ren, J.; Wang, T.; Wang, E.; Wang, J. Analyst 2015, 140, 2556. doi: 10.1039/C4AN02282C
[30]	Qin, H.; Ren, J.; Wang, J.; Wang, E. Chem. Commun. 2010, 46, 7385. doi: 10.1039/c0cc01695k
[31]	Qin, H. X.; Ren, J. T.; Wang, J. H.; Luedtke, N. W.; Wang, E. K. Anal. Chem. 2010, 82, 8356. doi: 10.1021/ac101894b
[32]	Sun, H.; Xiang, J.; Gai, W.; Liu, Y.; Guan, A.; Yang, Q.; Li, Q.; Shang, Q.; Su, H.; Tang, Y.; Xu, G. Chem. Commun. 2013, 49, 4510. doi: 10.1039/c3cc39020a
[33]	Chen, G.; Bai, W.; Jin, Y.; Zheng, J. Talanta 2021, 232, 122405. doi: 10.1016/j.talanta.2021.122405
[34]	Li, T.; Dong, S.; Wang, E. J. Am. Chem. Soc. 2010, 132, 13156. doi: 10.1021/ja105849m
[35]	Mizunuma, M.; Suzuki, M.; Kobayashi, T.; Hara, Y.; Kaneko, A.; Furukawa, K.; Chuman, Y. Int. J. Mol. Sci. 2023, 24, 11556. doi: 10.3390/ijms241411556
[36]	Bai, Y.; Feng, F.; Zhao, L.; Chen, Z.; Wang, H.; Duan, Y. Anal. Methods 2014, 6, 662. doi: 10.1039/C3AY42023J
[37]	Shen, Q.; Zhou, L.; Yuan, Y.; Huang, Y.; Xiang, B.; Chen, C.; Nie, Z.; Yao, S. Biosens. Bioelectron. 2014, 55, 187. doi: 10.1016/j.bios.2013.12.019
[38]	Oyoshi, T.; Masuzawa, T. Biochem. Biophys. Res. Commun. 2020, 531, 39. doi: 10.1016/j.bbrc.2020.02.178
[39]	Sun, Z.-Y.; Wang, X.-N.; Cheng, S.-Q.; Su, X.-X.; Ou, T.-M. Molecules 2019, 24, 396. doi: 10.3390/molecules24030396
[40]	Fan, X.; Qin, Y.; Jiang, B.; Yuan, R.; Xiang, Y. Sens. Actuators, B 2020, 304, 127351. doi: 10.1016/j.snb.2019.127351
[41]	Virgo, P.; Denning-Kendall, P. A.; Erickson-Miller, C. L.; Singha, S.; Evely, R.; Hows, J. M.; Freeman, S. D. Br. J. Haematol. 2003, 123, 420. doi: 10.1046/j.1365-2141.2003.04625.x
[42]	Wang, M.; Mao, Z.; Kang, T.-S.; Wong, C.-Y.; Mergny, J.-L.; Leung, C.-H.; Ma, D.-L. Chem. Sci. 2016, 7, 2516. doi: 10.1039/C6SC00001K
[43]	Zhou, N.; Su, F.; Guo, C.; He, L.; Jia, Z.; Wang, M.; Jia, Q.; Zhang, Z.; Lu, S. Biosens. Bioelectron. 2019, 123, 51. doi: S0956-5663(18)30776-0 pmid: 30308421
[44]	Lv, S.; Zhang, K.; Lin, Z.; Tang, D. Biosens. Bioelectron. 2017, 96, 317. doi: 10.1016/j.bios.2017.05.027
[45]	Yang, W.; Zhou, X.; Zhao, J.; Xu, W. Microchim. Acta 2018, 185, 100. doi: 10.1007/s00604-017-2620-6
[46]	Li, H.-Y.; Chang, J.-F.; Lyu, W.-X.; Li, F. Chin. J. Anal. Chem. 2020, 48, 1325 (in Chinese). doi: 10.1016/S1872-2040(20)60051-2
	(李海银, 常加富, 吕文欣, 李峰, 分析化学, 2020, 48, 1325.)
[47]	Shao, K.; Wang, B.; Nie, A.; Ye, S.; Ma, J.; Li, Z.; Lv, Z.; Han, H. Biosens. Bioelectron. 2018, 118, 160. doi: 10.1016/j.bios.2018.07.029
[48]	Delehanty, J. B.; Ligler, F. S. Anal. Chem. 2002, 74, 5687.
[49]	Espina, V.; Woodhouse, E. C.; Wulfkuhle, J.; Asmussen, H. D.; Petricoin, E. F.; Liotta, L. A. J. Immunol. Methods 2004, 290, 121. doi: 10.1016/j.jim.2004.04.013
[50]	Garg, S. K.; Tiwari, R. P.; Tiwari, D.; Singh, R.; Malhotra, D.; Ramnani, V. K.; Prasad, G.; Chandra, R.; Fraziano, M.; Colizzi, V.; Bisen, P. S. J. Clin. Lab. Anal. 2003, 17, 155. doi: 10.1002/jcla.v17:5
[51]	Shu, H.; Zhang, R.; Xiao, K.; Yang, J.; Sun, X. Biomolecules 2022, 12, 648. doi: 10.3390/biom12050648
[52]	Jouha, J.; Li, F.; Xiong, H. Spectrochim. Acta, Part A 2023, 295.
[53]	Zhao, L.; Ahmed, F.; Xiong, H. Chin. Chem. Lett. 2022, 33, 4243. doi: 10.1016/j.cclet.2022.02.048
[54]	Bai, D.; Ji, D.; Shang, J.; Hu, Y.; Gao, J.; Lin, Z.; Ge, J.; Li, Z. Sens. Actuators, B 2017, 252, 1146. doi: 10.1016/j.snb.2017.07.181
[55]	Xi, H.; Jiang, H.; Juhas, M.; Zhang, Y. Analyst 2022, 147, 4040. doi: 10.1039/D2AN01057G
[56]	Zhao, R.; Zhao, L.; Feng, H.; Chen, X.; Zhang, H.; Bai, Y.; Feng, F.; Shuang, S. Analyst 2021, 146, 1340. doi: 10.1039/D0AN02188A
[57]	Zhao, R.; Xiao, Y.; Tang, Y.; Lu, B.; Li, B. ACS Sensors 2024, 9, 4803. doi: 10.1021/acssensors.4c01233
[58]	Pratihar, S.; Agrawal, R.; Pal, V. K.; Singh, A.; Govindaraju, T. ACS Sensors 2022, 7, 453. doi: 10.1021/acssensors.1c02113 pmid: 35084824
[59]	Lv, M.; Ren, J.; Wang, E. Chem. Sci. 2024, 15, 4519. doi: 10.1039/D3SC06862E
[60]	Li, S.; Liu, C.; Gong, H.; Chen, C.; Chen, X.; Cai, C. Talanta 2018, 178, 974. doi: 10.1016/j.talanta.2017.10.023
[61]	Gilboa, T.; Garden, P. M.; Cohen, L. Anal. Chim. Acta 2020, 1115, 61. doi: S0003-2670(20)30308-1 pmid: 32370870
[62]	Lee, M.; Lee, M.; Song, Y.; Kim, S.; Park, N. Molecules 2024, 29, 4737. doi: 10.3390/molecules29194737
[63]	Wang, H.; Zhou, G.; Liu, H.; Peng, R.; Sun, T.; Li, S.; Chen, M.; Wang, Y.; Shi, Q.; Xie, X. Viruses 2024, 16, 1548. doi: 10.3390/v16101548
[64]	Kreitmann, L.; Miglietta, L.; Xu, K.; Malpartida-Cardenas, K.; D'Souza, G.; Kaforou, M.; Brengel-Pesce, K.; Drazek, L.; Holmes, A.; Rodriguez-Manzano, J. TrAC, Trends Anal. Chem. 2023, 160, 116963.
[65]	Stellrecht, K. A. Expert Rev. Mol. Diagn. 2004, 4, 485. pmid: 15225096
[66]	Wang, L. L.; Tang, R. T.; Wang, W. T.; Bu, L. G.; Sun, J. L.; Fu, Y. R.; Li, M.; Yi, Z. J. Anal. Methods 2025, 17, 652. doi: 10.1039/D4AY01106F
[67]	Chen, Y.; Zhang, J.; Sui, L.; Li, Y. Microchem. J. 2025, 209, 112737. doi: 10.1016/j.microc.2025.112737
[68]	Xu, J.; Jiang, R.; He, H.; Ma, C.; Tang, Z. TrAC, Trends Anal. Chem. 2021, 139, 116257.
[69]	Zhao, X.; Liu, W.; Qu, R.; Jiang, X.; Chen, J.; Chen, P. Sens. Actuators, B 2025, 430, 137372. doi: 10.1016/j.snb.2025.137372
[70]	Sheng, N.; Ma, X. P.; Pang, S. Y.; Song, Q. X.; Zou, B. J.; Zhou, G. H. Chin. J. Anal. Chem. 2020, 48, 1279. doi: 10.1016/S1872-2040(20)60048-2
[71]	Xi, H.; Juhas, M.; Zhang, Y. Biosens. Bioelectron. 2020, 167, 112494. doi: 10.1016/j.bios.2020.112494
[72]	Pratihar, S.; Mattath, M. N.; Govindaraju, T. Chem. Commun. 2023, 59, 5717. doi: 10.1039/D3CC00740E
[73]	Mori, M. A.; Ludwig, R. G.; Garcia-Martin, R.; Brandão, B. B.; Kahn, C. R. Cell Metab. 2019, 30, 656. doi: 10.1016/j.cmet.2019.07.011
[74]	Dragomir, M. P.; Knutsen, E.; Calin, G. A. Trends Genet. 2022, 38, 379. doi: 10.1016/j.tig.2021.10.002
[75]	Cekaite, L.; Eide, P. W.; Lind, G. E.; Skotheim, R. I.; Lothe, R. A. Oncotarget 2015, 7, 6476. doi: 10.18632/oncotarget.v7i6
[76]	Liu, M. X.; Liang, S.; Tang, Y.; Tian, J.; Zhao, Y.; Zhao, S. RSC Adv. 2018, 8, 15967. doi: 10.1039/C8RA01605D
[77]	Liao, T.-C.; Ma, T.-Z.; Chen, S.-B.; Cilibrizzi, A.; Zhang, M.-J.; Li, J.-H.; Zhou, C.-Q. Int. J. Biol. Macromol. 2020, 158, 1299. doi: 10.1016/j.ijbiomac.2020.04.171
[78]	Sun, H.; Sun, R.; Yang, D.; Li, Q.; Jiang, W.; Zhou, T.; Bai, R.; Zhong, F.; Zhang, B.; Xiang, J.; Liu, J.; Tang, Y.; Yao, L. J. Am. Chem. Soc. 2024, 146, 22736. doi: 10.1021/jacs.4c07698
[79]	Han, J.-N.; Zhong, C.; Ge, M.; Kuang, S.; Nie, Z. Chem. Sci. 2023, 14, 4538. doi: 10.1039/D3SC00022B
[80]	Suseela, Y. V.; Narayanaswamy, N.; Pratihar, S.; Govindaraju, T. Chem. Soc. Rev. 2018, 47, 1098. doi: 10.1039/c7cs00774d pmid: 29264610
[81]	Zhang, L.; Liu, X.; Lu, S.; Liu, J.; Zhong, S.; Wei, Y.; Bing, T.; Zhang, N.; Shangguan, D. ACS Appl. Bio Mater. 2020, 3, 2643. doi: 10.1021/acsabm.9b01243
[82]	Gan, L.; Luo, W.; Cheng, Q.; Wan, S.; Wu, M.; Wang, M.; Luo, E.; Luo, X.; Li, S. Results Chem. 2025, 13, 102005. doi: 10.1016/j.rechem.2024.102005
[83]	Liu, L.; Zhang, W.; Zhong, M.-Q.; Jia, M.-H.; Jiang, F.; Zhang, Y.; Xiao, C.-D.; Xiao, X.; Shen, X.-C. RSC Adv. 2022, 12, 14765. doi: 10.1039/D2RA01433E
[84]	Kang, Y.; Wei, C. Spectrochim. Acta, Part A 2022, 267, 120518. doi: 10.1016/j.saa.2021.120518
[85]	Bedrat, A.; Lacroix, L.; Mergny, J.-L. Nucleic Acids Res. 2016, 44, 1746. doi: 10.1093/nar/gkw006 pmid: 26792894
[86]	Teng, F.-Y.; Jiang, Z.-Z.; Guo, M.; Tan, X.-Z.; Chen, F.; Xi, X.-G.; Xu, Y. Cell. Mol. Life Sci. 2021, 78, 6557. doi: 10.1007/s00018-021-03921-8
[87]	Eddy, J.; Maizels, N. Nucleic Acids Res. 2006, 34, 3887. doi: 10.1093/nar/gkl529
[88]	Hershman, S. G.; Chen, Q.; Lee, J. Y.; Kozak, M. L.; Yue, P.; Wang, L.-S.; Johnson, F. B. Nucleic Acids Res. 2008, 36, 144. doi: 10.1093/nar/gkm986 pmid: 17999996
[89]	Hu, M.-H. Anal. Chim. Acta 2021, 1169, 338600. doi: 10.1016/j.aca.2021.338600
[90]	Guan, L.; Mao, Y.; Zhou, Y.; Fu, Y.; Li, A.; Mei, J.; Zhou, H.; Han, G.; Yin, L.; Wang, L. Dyes Pigm. 2023, 215, 111286. doi: 10.1016/j.dyepig.2023.111286
[91]	Liu, J.; Sun, L.; Hong, Y.; Deng, J.; Luo, Q.; Zeng, R.; Chen, W. Spectrochim. Acta, Part A 2024, 318, 124489. doi: 10.1016/j.saa.2024.124489
[92]	Zhang, Y.; Cheng, Y.; Liu, X.; Tang, H.; Wang, F.; Tang, L.-J.; Jiang, J.-H. Anal. Chem. 2024, 96, 17329. doi: 10.1021/acs.analchem.4c03722 pmid: 39412418
[93]	Wang, R.; Zhang, Z.-L.; Hu, M.-H. Int. J. Biol. Macromol. 2025, 302, 140556. doi: 10.1016/j.ijbiomac.2025.140556
[94]	Ren, Y.; Dong, Y.; Li, Z.; Xu, K.; Xu, J.; Li, X.; Zhang, M.; Xu, C.; Yang, M.; Lee, M.; Meng, X.; Wang, J. Biomaterials 2025, 320, 123237. doi: 10.1016/j.biomaterials.2025.123237

G-四链体荧光探针的应用进展